Rhesus CTRC/chymotrypsin C Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:CGB910-NO

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
807bp
Gene Synonym
CTRC
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus chymotrypsin C (caldecrin) Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Chymotrypsin C (abbreviated for CTRC), also known as caldecrin or elastase4, is a digestive enzyme of the peptidase S1 family. This enzyme is synthesized as an inactivate chymotrypsinogen. On cleavage by trypsin into two parts that activate each other by removing two small peptides in a trans-proteolysis, chymotrypsin C produced. N-linked glycosylation of human CTRC is required for efficient folding and secretion, however, the N-linked glycan is unimportant for enzyme activity or inhibitor binding. It has been proposed that CTRC is a key regulator of digestive zymogen activation and a physiological co-activator of digestive carboxypeptidases proCPA1 and proCPA2. Mutations that abolish activity or secretion of CTRC increase the risk for chronic pancreatitis. It's speculated that CTRC might regulate pancreatic cancer cell migration in relation to cytokeratin 18 expression. The pancreatic cancer cell migration ability was downregulated in pancreatic cancer Aspc-1 cells that overexpressed CTRC, whereas the cell migration ability was upregulated in Aspc-1 cells in which CTRC was suppressed. 
References
  • Lacruz RS, et al. (2011) Chymotrypsin C (caldecrin) is associated with enamel development. J Dent Res. 90 (10): 1228-33.
  • Zhou J, et al. (2011) Chymotrypsin C mutations in chronic pancreatitis. J Gastroenterol Hepatol. 26 (8): 1238-46.
  • Wang H, et al. (2011) Effect of chymotrypsin C and related proteins on pancreatic cancer cell migration. Acta Biochim Biophys Sin (Shanghai). 43 (5): 362-71.
  • TOP