Rhesus CSNK2A1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:CGB879-CF

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1176bp
Gene Synonym
CSNK2A1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus casein kinase 2, alpha 1 polypeptide Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Casein kinase II subunit alpha, also known as CK II alpha, CSNK2A1 and CK2A1, is a member of the protein kinase superfamily, Ser / Thr protein kinase family and CK2 subfamily. Casein kinase II (CSNK2A1) is a serine / threonine protein kinase that phosphorylates acidic proteins such as casein. This kinase is composed of an alpha, an alpha-prime, and two beta subunits. The alpha subunits contain the catalytic activity while the beta subunits undergo autophosphorylation. Casein kinase II (CSNK2A1) is a constitutively active, ubiquitously expressed serine / threonine protein kinase that is thought to have a regulatory function in cell proliferation, cell differentiation and apoptosis. CSNK2A1 functions as a tetrameric complex consisting of two regulatory beta-subunits and two catalytic units (alpha and alpha') in a homomeric or heteromeric conformation. Whilst the alpha- and alpha'-subunits are catalytically identical, proteins that regulate CSNK2A1, such as cdc2 and Hsp90, preferentially bind to the alpha and not the alpha'-subunit. CSNK2A1 can phosphorylate a number of key intracellular signaling proteins implicated in tumor suppression (p53 and PTEN) and tumorigenesis (myc, jun, NF-kappaB). CSNK2A1 is also thought to influence Wnt signaling via beta-catenin phosphorylation and the PI 3-K signaling pathway via th phosphorylation of Akt.
References
  • Schlpfer J, et al. (1997) A radiation hybrid framework map of bovine chromosome 13. Chromosome Res. 5(8): 511-9.
  • Wirkner U, et al. (1994) The human gene (CSNK2A1) coding for the casein kinase II subunit alpha is located on chromosome 20 and contains tandemly arranged Alu repeats. Genomics. 19(2): 257-65.
  • Wirkner U, et al. (1998) Genomic organization and promoter identification of the human protein kinase CK2 catalytic subunit alpha (CSNK2A1). Genomics. 48(1): 71-8.
  • TOP