Rat CLPS / Colipase Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_013139.1

RefSeq ORF Size

339bp

Gene Synonym

COLQ

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat colipase, pancreatic Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Colipase belongs to the colipase family. Structural studies of the complex and of colipase alone have revealed the functionality of its architecture. It is a small protein with five conserved disulphide bonds. Structural analogies have been recognised between a developmental protein, the pancreatic lipase C-terminal domain, the N-terminal domains of lipoxygenases and the C-terminal domain of alpha-toxin. Colipase can only be detected in pancreatic acinar cells, suggesting regulation of expression by tissue-specific elements. Colipase allows lipase to anchor noncovalently to the surface of lipid micelles, counteracting the destabilizing influence of intestinal bile salts. Without colipase the enzyme is washed off by bile salts, which have an inhibitory effect on the lipase. Colipase is a cofactor needed by pancreatic lipase for efficient dietary lipid hydrolysis. It binds to the C-terminal, non-catalytic domain of lipase, thereby stabilising as active conformation and considerably increasing the overall hydrophobic binding site.

References

Davis RC, et al. (1991) Assignment of the human pancreatic colipase gene to chromosome 6p21.1 to pter. Genomics. 10(1):262-5.

Lowe ME. (1997) Structure and function of pancreatic lipase and colipase. Annu Rev Nutr. 17: 141-58.

Verger R, et al. (1999) Colipase: structure and interaction with pancreatic lipase. Biochim Biophys Acta. 1441(2-3):173-84.

Catalog Number:CGB666-NM