Rat CD86/B7-2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Rat

NCBI Ref Seq

NM_020081.1

RefSeq ORF Size

942bp

Gene Synonym

B7-2, Cd86

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat CD86 molecule Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

CD86, also known as B-lymphocyte activation antigen B7-2 (referred to as B70), is a member of the cell surface immunoglobulin superfamily. B7-2 exists predominantly as a monomer on cell surfaces and interacts with two co-stimulatory receptors CD28 and cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) expressed on T cells, and thus induces the signal pathways which regulate T cell activation and tolerance, cytokine production, and the generation of CTL. It is indicated that contacts between B and T helper cells mediated by CD86 encourage signals for the proliferation and IgG secretion of normal B cells and B cell lymphomas. Recent study has revealed that CD86 also promotes the generation of a mature APC repertoire and promotes APC function and survival. CD86 has an important role in chronic hemodialysis, allergic pulmonary inflammation, arthritis, and antiviral responses, and thus is regarded as a promising candidate for immune therapy.

References

Chen YQ, et al. (2006) CD28/CTLA-4--CD80/CD86 and ICOS--B7RP-1 costimulatory pathway in bronchial asthma. Allergy. 61(1): 15-26.

Rau FC, et al. (2009) B7-1/2 (CD80/CD86) direct signaling to B cells enhances IgG secretion. J Immunol. 183(12): 7661-71.

Dai ZS, et al. (2009) Defective expression and modulation of B7-2/CD86 on B cells in B cell chronic lymphocytic leukemia. Int J Hematol. 89(5): 656-63.

Catalog Number:CGB395-CF