Rat CD81/TAPA1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:CGB390-CF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
711bp
Gene Synonym
Tapa1, Cd81
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat Cd81 molecule Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CD81, also known as TAPA-1, belongs to the transmembrane 4 superfamily, also known as the tetraspanin family. Members of this family mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility.CD81 is a widely expressed cell-surface protein involved in an astonishing variety of biologic responses. It is related to adhesion, morphology, activation, proliferation, and differentiation of B, T, and other cells. On B cells CD81 is part of a complex with CD21, CD19, and Leu13. This complex reduces the threshold for B cell activation via the B cell receptor by bridging Ag specific recognition and CD21-mediated complement recognition.
References
  • Petracca R. et al., 2000, J Virol. 74 (10): 4824-30.
  • Bartosch B. et al., 2003, The Journal of Biological Chemistry. 278 (43): 41624-30.
  • Clark KL. et al., 2001, Journal of Immunology. 167 (9): 5115-21.
  • TOP