Cynomolgus CD74 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Cynomolgus

NCBI Ref Seq

XM_005558265.1

RefSeq ORF Size

885bp

Gene Synonym

CD74

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Cynomolgus CD74 molecule, major histocompatibility complex, class II invariant chain Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD74, also known as HLA class2 histocompatibility antigen gamma chain and HLA-DR antigens-associated invariant chain, is a polypeptide involved in the formation and transport of MHC class2 protein. CD74 is expressed by B cells, macrophages, and Reed-Sternberg cells. When MHC class 2 protein was in the rough ER, its peptide-binding cleft was blocked by CD74 to prevent it from interacting with the endogenous peptides. CD74 also serves to facilitate MHC class2's export from ER.

References

Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.

Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.

Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.

Moynes R, et al. (1997) A marker to distinguish atypical fibroxanthoma from malignant fibrous histiocytoma. Cancer. 79 (11): 2115-24.

Gabrielle FA, et al. (2008) Regulation of dendritic cell migration by CD74, the MHC class 2-associated invariant chain. Science. 322 (5908): 1705-10.

Leng L, et al. (2003) MIF signal transduction initiated by binding to CD74. JEM.197 (11): 1467-76.

Catalog Number:CGB383-CF