Rat CD70/CD27L/TNFSF7 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:CGB380-CF

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
588bp
Gene Synonym
Cd70
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat Cd70 molecule Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CD70, a member of the tumor necrosis factor superfamily, is restricted to activated T-and B-lymphocytes and mature dendritic cells. Binding of CD70 to its receptor, CD27, is important in priming, effector functions, differentiation and memory formation of T-cells as well as plasma and memory B-cell generation. Tight control of CD70 expression is required to prevent lethal immunodeficiency. By selective transcription, CD70 is largely confined to activated lymphocytes and dendritic cells (DC). As a type II transmembrane receptor, CD70 is normally expressed on a subset of B, T and NK cells, where it plays a costimulatory role in immune cell activation. Immunohistochemical analysis of CD70 expression in multiple carcinoma types. The restricted expression pattern of CD70 in normal tissues and its widespread expression in various malignancies makes it an attractive target for antibody-based therapeutics. Investigations to exploit CD70 as a cancer target have lead to the identification of potential antibody-based clinical candidates.
References
  • Adam PJ, et al. (2006) CD70 (TNFSF7) is expressed at high prevalence in renal cell carcinomas and is rapidly internalised on antibody binding. Br J Cancer. 95(3): 298-306.
  • Keller AM, et al. (2007) Costimulatory ligand CD70 is delivered to the immunological synapse by shared intracellular trafficking with MHC class II molecules. Proc Natl Acad Sci U S A. 104(14): 5989-94.
  • Grewal IS. (2008) CD70 as a therapeutic target in human malignancies. Expert Opin Ther Targets. 12(3): 341-51.
  • Boursalian TE, et al. (2009) Targeting CD70 for human therapeutic use. Adv Exp Med Biol. 647: 108-19.
  • TOP