Rhesus CD3e/CD3 epsilon Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Rhesus

NCBI Ref Seq

XM_001097204.2

RefSeq ORF Size

597bp

Gene Synonym

CD3e

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rhesus CD3e molecule, epsilon (CD3-TCR complex) Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

T-cell surface glycoprotein CD3 epsilon chain, also known as CD3E, is a single-pass type I membrane protein. CD3E contains 1 Ig-like (immunoglobulin-like) domain and 1 ITAM domain. CD3E, together with CD3-gamma, CD3-delta and CD3-zeta, and the T-cell receptor alpha/beta and gamma/delta heterodimers, forms the T cell receptor-CD3 complex. The CD3 epsilon subunit of the T cell receptor (TCR) complex contains two defined signaling domains, a proline-rich sequence and an immune tyrosine activation motifs (ITAMs), and this complex undergoes a conformational change upon ligand binding that is thought to be important for the activation of T cells. In the CD3 epsilon mutant mice, all stages of T cell development and activation that are TCR-dependent were impaired, but not eliminated, including activation of mature naïve T cells with the MHCII presented superantigen, staphylococcal enterotoxin B, or with a strong TCR cross-linking antibody specific for either TCR-Cbeta or CD3 epsilon. T cell receptor-CD3 complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. This complex is critical for T-cell development and function, and represents one of the most complex transmembrane receptors. CD3E plays an essential role in T-cell development, and defects in CD3E gene cause severe immunodeficiency. Homozygous mutations in CD3D and CD3E genes lead to a complete block in T-cell development and thus to an early-onset severe combined immunodeficiency phenotype.

References

Fischer A, et al. (2005) CD3 deficiencies. Curr Opin Allergy Clin Immunol. 5(6): 491-5.

Wang Y, et al. (2009) A conserved CXXC motif in CD3epsilon is critical for T cell development and TCR signaling. PLoS Biol. 7(12): e1000253.

Martnez-Martn N, et al. (2009) Cooperativity between T cell receptor complexes revealed by conformational mutants of CD3epsilon. Sci Signal. 2(83): ra43.

Deford-Watts LM, et al. (2009) The cytoplasmic tail of the T cell receptor CD3 epsilon subunit contains a phospholipid-binding motif that regulates T cell functions. J Immunol. 183(2): 1055-64.

Catalog Number:CGB348-CF