Rhesus CD33/Siglec-3 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:CGB339-NY

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
699bp
Gene Synonym
CD33
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus CD33 molecule Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Myeloid cell surface antigen CD33 also known as Sialic acid binding Ig-like lectin 3, CD33 antigen or Siglec-3, is a member of the immunoglobulin superfamily and SIGLEC (sialic acid binding Ig-like lectin) family. This Single-pass type I membrane protein contains 1 Ig-like C2-type (immunoglobulin-like) domain and 1 Ig-like V-type (immunoglobulin-like) domain. CD33 /Siglec-3 is a putative adhesion molecule of myelomonocytic-derived cells that mediates sialic-acid dependent binding to cells. CD33 /Siglec-3 preferentially binds to alpha-2,6-linked sialic acid. The sialic acid recognition site may be masked by cis interactions with sialic acids on the same cell surface. In the immune response, may act as an inhibitory receptor upon ligand induced tyrosine phosphorylation by recruiting cytoplasmic phosphatase(s) via their SH2 domain(s) that block signal transduction through dephosphorylation of signaling molecules. CD33/Siglec-3 induces apoptosis in acute myeloid leukemia (in vitro). CD33/Siglec-3 can function as a sialic acid-dependent cell adhesion molecule and that binding can be modulated by endogenous sialoglycoconjugates when CD33 is expressed in a plasma membrane.
References
  • Simmons D, et al. (1988) Isolation of a cDNA encoding CD33, a differentiation antigen of myeloid progenitor cells. J Immunol. 141(8): 2797-800.
  • Ulyanova T, et al. (1999) The sialoadhesin CD33 is a myeloid-specific inhibitory receptor. Eur J Immunol. 29(11): 3440-9.
  • Freeman SD, et al. (1995) Characterization of CD33 as a new member of the sialoadhesin family of cellular interaction molecules. Blood. 85(8): 2005-12.
  • TOP