Rat CD27/TNFRSF7 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_001024335.1

RefSeq ORF Size

756bp

Gene Synonym

Tnfrsf7, MGC112688

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat CD27 molecule Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

CD27, also known as TNFRSF7, is a member of the TNF-receptor superfamily limited to cells of the lymphoid lineage, and exists as both a dimeric glycoprotein on the cell surface and as a soluble protein in serum. As a type I transmembrane glycoprotein of about 55 kDa existing as disulfide-linked homodimer, CD27 has been shown to play roles in lymphoid proliferation, differentiation, and apoptosis.It has important role in generation of T cell immunity, and is an apparently robust marker for normal memory B cells. It is a T and B cell co-stimulatory molecule, the activity of CD27 is governed by its TNF-like ligand CD70 on lymphocytes and dendritic cells. The CD27-CD70 interaction is required for Th1 generation responses to differentiation signals and long-term maintenance of T cell immunity, and meanwhile, plays a key role in regulating B-cell differentiation, activation and immunoglobulin synthesis.

References

Drner T, et al. (2004) Correlation of circulating CD27 high plasma cells and disease activity in systemic lupus erythematosus. Lupus. 13(5): 283-9.

Sahota SS, et al. (2009) CD27 in defining memory B-cell origins in Waldenstrm's macroglobulinemia. Clin Lymphoma Myeloma. 9(1): 33-5.

Jiang J, et al. (2010) Reduced CD27 expression on antigen-specific CD4+ T cells correlates with persistent active tuberculosis. J Clin Immunol. 30(4): 566-73.

Catalog Number:CGB321-NM