Rhesus CD208/DC-LAMP Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:CGB311-NF

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1251bp
Gene Synonym
LAMP3
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus lysosomal-associated membrane protein 3 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Dendritic cell-lysosomal associated membrane protein (DC-LAMP)/CD208, also known as LAMP3, is a member of the lysosomal associated membrane protein (LAMP) family, which is specifically expressed by human dendritic cells (DCs) upon activation and therefore serves as marker of human DC maturation. Confocal and immunoelectron microscopy showed that mouse DC-LAMP protein co-localizes with lbm180, a specific marker for the limiting membrane of lamellar bodies that contain surfactant protein B. The present study demonstrates that DC-LAMP is constitutively expressed by mouse, sheep, and human type II pneumocytes. DC-LAMP is constitutively expressed in normal type II pneumocytes. DC-LAMP is detected first in activated human DC within MHC class II molecules-containing compartments just before the translocation of MHC class II-peptide complexes to the cell surface, suggesting a possible involvement in this process. Furthermore, overexpression of LAMP3 is actively involved in tumor invasion through increased migration into lymph-vascular spaces.
References
  • Salaun B, et al. (2003) Cloning and characterization of the mouse homologue of the human dendritic cell maturation marker CD208/DC-LAMP. Eur J Immunol. 33(9): 2619-29.
  • Salaun B, et al. (2004) CD208/dendritic cell-lysosomal associated membrane protein is a marker of normal and transformed type II pneumocytes. Am J Pathol. 164(3): 861-71.
  • Ishigami S, et al. (2010) Prognostic value of CD208-positive cell infiltration in gastric cancer. Cancer Immunol Immunother. 59(3): 389-95.
  • TOP