Rhesus CD160/NK1/BY55 Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:CGB284-CM

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
546bp
Gene Synonym
CD160
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus CD160 molecule Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CD160 antigen, also known as Natural killer cell receptor BY55 and CD160, is a cell membrane protein which contains one Ig-like V-type (immunoglobulin-like) domain. CD160 is a GPI-anchored lymphocyte surface receptor in which expression is mostly restricted to the highly cytotoxic CD56(dim)CD16(+) peripheral blood NK subset. CD160 is a receptor showing broad specificity for both classical and non-classical MHC class I molecules. CD160 is expressed in spleen, peripheral blood, and small intestine. Expression of CD160 is restricted to functional NK and T cytotoxic lymphocytes. CD160 acts as a co-activator receptor for CD3-induced proliferation of CD4+ CD160+ T cells isolated from inflammatory skin lesions. Unique CD4+ CD160+ lymphocyte subset may play a role in the pathogenesis of skin inflammation. Activated NK lymphocytes release a soluble form of CD160 that functionally impairs the MHC-I-specific cytotoxic CD8(+) T lymphocyte responsiveness.
References
  • Barakonyi A. et al., 2004, J Immunol.173 (9): 5349-54.
  • Rabot M. et al., 2006, Transpl Immunol. 17 (1): 36-8.
  • Abecassis S. et al., 2007, J Invest Dermatol. 127?(5): 1161-6.
  • Giustiniani J.?et al., 2007, J Immunol. 178 (3): 1293-300.
  • TOP