Cynomolgus CD147/EMMPRIN/Basigin Gene ORF cDNA clone expression plasmid,C terminal GFP tag

Catalog Number:CGB273-CG

Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
822bp
Gene Synonym
BSG
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Cynomolgus basigin (Ok blood group) Gene ORF cDNA clone expression plasmid,C terminal GFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-GFPSpark
Restriction Site
Protein Tag
GFPSpark
Tag Sequence
GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
GFPSpark Tag Information
GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CD147/EMMPRIN (Extracellular Matrix Metalloproteinase Inducer), also known as Basigin (BSG), is a transmembrane glycoprotein with different forms resulted from different modes of glycosylation and N-terminal sequence variants. It is a member of the immunoglobulin superfamily with homology to both the immunoglobulin V domain and MHC class II antigen beta-chain. This protein play important roles in variety of events including spermatogenesis, embryo implantation, neural network formation. CD147 induces the production and release of matrix metalloproteinases (MMP) in the surrounding mesenchymal cells and tumor cells, and thereby promotes invasion, metastasis, growth and survival of malignant cells. Furthermore, CD147 also serves as a receptor for extracellular cyclophilinthe and its association with integrins might be important in signal transduction. Recently, CD147 displays increased expression in many cancers, and it has been previously demonstrated to participate in cancer metastasis and progression. Thus, CD147 and its antibody are used as an effective treatment for malignant cancers.
References
  • Tang Y, et al. (2004) Tumor-stroma interaction: positive feedback regulation of extracellular matrix metalloproteinase inducer (EMMPRIN) expression and matrix metalloproteinase-dependent generation of soluble EMMPRIN. Mol Cancer Res. 2(2): 73-80.
  • Wilson MC, et al. (2005) Basigin (CD147) is the target for organomercurial inhibition of monocarboxylate transporter isoforms 1 and 4: the ancillary protein for the insensitive MCT2 is EMBIGIN (gp70). J Biol Chem. 280(29): 27213-21.
  • Curtin KD, et al. (2005) Basigin (EMMPRIN/CD147) interacts with integrin to affect cellular architecture. J Cell Sci. 118(Pt 12): 2649-60.
  • Zhu H, et al. (2009) A novel antibody fragment targeting HAb18G/CD147 with cytotoxicity and decreased immunogenicity. Cancer Biol Ther. 8(11): 1035-44. Zhu H, et al. (2009) A novel antibody fragment targeting HAb18G/CD147 with cytotoxicity and decreased immunogenicity. Cancer Biol Ther. 8(11): 1035-44.
  • Seizer P, et al. (2009) EMMPRIN (CD147) is a novel receptor for platelet GPVI and mediates platelet rolling via GPVI-EMMPRIN interaction. Thromb Haemost. 101(4): 682-6.
  • Moonsom S, et al. (2010) A Competitive ELISA for Quantifying Serum CD147: Reduction of Soluble CD147 Levels in Cancer Patient Sera. Hybridoma (Larchmt). 29(1): 45-52.
  • TOP