Rat CD122 / IL-2RB Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:CGB265-NY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1614bp
Gene Synonym
IL2RBC, Il2rb
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat interleukin 2 receptor, beta Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Interleukin-2 receptor (IL-2R) also known as High affinity IL-2 receptor subunit beta, IL-2 receptor subunit beta, and IL-2RB, is involved in T cell-mediated immune responses. CD122/IL-2RB is present in 3 forms with respect to ability to bind interleukin 2. The low affinity form is a monomer of the alpha subunit and is not involved in signal transduction. The intermediate affinity form consists of an alpha/beta subunit heterodimer, while the high affinity form consists of an alpha/beta/gamma subunit heterotrimer. Both the intermediate and high affinity forms of CD122/IL-2RB are involved in receptor-mediated endocytosis and transduction of mitogenic signals from interleukin 2. CD122/IL-2RB expression was restricted to the earliest B220+ cells (CD43+CD24-; prepro B cells; fraction A) that proliferate vigorously to IL-2 in the absence of any stromal cells, but not to IL-15. The high-affinity form of this receptor is expressed on activated T lymphocytes, activated B lymphocytes, and activated macrophages. CD122/IL-2RB plays a role in regulating normal lymphocyte development.
References
  • Foss F. (2006) Clinical experience with denileukin diftitox (ONTAK). Semin Oncol. 33(1 Suppl 3): 11-6.
  • Sprent J, et al. (2001) T cell death and memory. Science. 293(5528): 245-8.
  • Teshigawara K, et al. (1987) Interleukin 2 high-affinity receptor expression requires two distinct binding proteins. J Exp Med. 165 (1): 223-38.
  • TOP