Canine CCN3 / NOV (IGFBP9) Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:CGB233-NO

Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
1062bp
Gene Synonym
NOV
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Canine nephroblastoma overexpressed gene Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Protein NOV homolog, also known as Nephroblastoma-overexpressed gene protein homolog, NOV, and CCN3, is a putative ligand for integrin receptors, is tightly associated with the extracellular matrix and mediates diverse cellular functions, including cell adhesion and proliferation. CCN3 has been shown to negatively regulate growth although it promotes migration in a cell type-specific manner. This secreted protein belongs to the CCN family, and its expression was observed in a broad variety of tissues from the early stage of development , and altered expression of CCN3 has been observed in a variety of tumors, including hepatocellular carcinomas, Wilm's tumors, Ewing's sarcomas, gliomas, rhabdomyosarcomas, and adrenocortical carcinomas. Mature CCN3 protein has five distinct modules and truncated protein variants with altered function are found in many cancers. CCN3 acts through the core stem cell signalling pathways including Notch and Bone Morphogenic Protein, connecting CCN3 with the modulation of self-renewal and maturation of a number of cell lineages including hematopoietic, osteogenic and chondrogenic. CCN3 may affect the extracellular environment of the niche for hematopoietic stem cells. CCN3 has emerged as a key player in stem cell regulation, hematopoiesis and a crucial component within the bone marrow microenvironment.
References
  • Manara MC, et al. (2002) The expression of ccn3(nov) gene in musculoskeletal tumors. Am J Pathol. 160(3): 849-59.
  • Lin CG, et al. (2003) CCN3 (NOV) is a novel angiogenic regulator of the CCN protein family. J Biol Chem. 278(26): 24200-8.
  • Vallacchi V, et al. (2009) CCN3/nephroblastoma overexpressed matricellular protein regulates integrin expression, adhesion, and dissemination in melanoma. Cancer Res. 68(3): 715-23.
  • Sin WC, et al. (2009) Matricellular protein CCN3 (NOV) regulates actin cytoskeleton reorganization. J Biol Chem. 284(43): 29935-44.
  • McCallum L, et al. (2009) CCN3--a key regulator of the hematopoietic compartment. Blood Rev. 23(2): 79-85.
  • TOP