Rat Cadherin-17/LI-cadherin Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_053977.2

RefSeq ORF Size

2484bp

Gene Synonym

Cdh17

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat cadherin 17 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Cadherin-17 or LI-cadherin is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. Cadherin-17/LI-cadherin is a cadherin-like protein consisting of an extracellular region, 7 cadherin domains, and a transmembrane region but lacking the conserved cytoplasmic domain. The protein is a component of the gastrointestinal tract and pancreatic ducts, acting as an intestinal proton-dependent peptide transporter in the first step in oral absorption of many medically important peptide-based drugs. The protein may also play a role in the morphological organization of liver and intestine. Alternative splicing of the encoding gene results in multiple transcript variants. Cadherin-17/LI-cadherin preferentially interact with themselves in a homophilic manner in connecting cells. Cadherin-17 may thus contribute to the sorting of heterogeneous cell types and have a role in the morphological organization of liver and intestine. It's also involved in intestinal peptide transport. Experiments have reported the association between Cadherin-17/LI-cadherin and gastric cancer. Cadherin-17/LI-cadherin expression was detected in 63/94 of gastric adenocarcinomas in addition to intestinal metaplasia. The expression of Cadherin-17 tended to be associated with intestinal type carcinoma, and carcinomas with Cadherin-17 expression was significantly more frequent in advanced stage cases than in early stage. Cadherin-17 is also a useful immunohistochemical marker for diagnosis of adenocarcinomas of the digestive system.

References

Liu LX, et al. (2009) Targeting cadherin-17 inactivates Wnt signaling and inhibits tumor growth in liver carcinoma. Hepatology. 50(5): 1453-63.

Ito R, et al. (2005) Clinicopathological significant and prognostic influence of cadherin-17 expression in gastric cancer. Virchows Arch. 447(4): 717-22.

Horsfield J, et al. (2002) Cadherin-17 is required to maintain pronephric duct integrity during zebrafish development. Mech Dev. 115(1-2): 15-26.

Catalog Number:CGB038-NM