Rat BCMA/TNFRSF17/CD269 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:CGA779-CO

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
555bp
Gene Synonym
Tnfrsf17
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat tumor necrosis factor receptor superfamily, member 17 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Tumor necrosis factor receptor superfamily, member 17 (TNFRSF17), also known as B cell maturation antigen (BCMA) or CD269 antigen, is a member of the TNF-receptor superfamily. This receptor is preferentially expressed in mature B lymphocytes, and may be important for B cell development and autoimmune response. This receptor has been shown to specifically bind to the tumor necrosis factor (ligand) superfamily, member 13b (TNFSF13BBAFF), and to lead to NF-kappaB and MAPK8/JNK activation. TNFRSF17/BCMA/CD269 also binds to various TRAF family members, and thus may transduce signals for cell survival and proliferation. TNFRSF17/BCMA/CD269 is a receptor for TALL-1 and BCMA activates NF-kappaB through a TRAF5-, TRAF6-, NIK-, and IKK-dependent pathway. The identification of TNFRSF17 as a NF-kappaB-activating receptor for TALL-1 suggests molecular targets for drug development against certain immunodeficient or autoimmune diseases. TNFRSF17/BCMA is a target of donor B-cell immunity in patients with myeloma who respond to DLI. Antibody responses to cell-surface BCMA may contribute directly to tumor rejection in vivo.
References
  • Novak AJ, et al. (2004) Expression of BCMA, TACI, and BAFF-R in multiple myeloma: a mechanism for growth and survival. Blood. 103 (2): 689–94.
  • O'Connor BP, et al. (2004) BCMA is essential for the survival of long-lived bone marrow plasma cells. J Exp Med. 199(1): 91-8.
  • Moser K, et al. (2006) Stromal niches, plasma cell differentiation and survival. Curr Opin Immunol. 18(3): 265-70.
  • TOP