Rhesus Autotaxin/ENPP2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Rhesus

NCBI Ref Seq

XM_001093656.2

RefSeq ORF Size

2592bp

Gene Synonym

ENPP2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rhesus ectonucleotide pyrophosphatase/phosphodiesterase 2 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

ENPP2 (Ectonucleotide pyrophosphatase/phosphodiesterase family member 2), also referred as Autotaxin, is a secreted enzyme encoded by the ENPP2 gene. This gene product stimulates the motility of tumor cells, has angiogenic properties, and its expression is upregulated in several kinds of carcinomas. The Autotaxin protein is important for generating the lipid signaling molecule lysophosphatidic acid (LPA), which is a potent mitogen, which facilitates cell proliferation and migration, neurite retraction, platelet aggregation, smooth muscle contraction, actin stress formation and cytokine and chemokine secretion. ATX has been found to catalyze the formation of cyclic phosphatidic acid (cPA), which have antitumor role by antimitogenic regulation of cell cycle, inhibition of cancer invasion and metastasis. LPA receptors and ATX are upregulated in numerous cancer cell types and show expression patterns that correlate with tumor cell invasiveness. Thus, Autotaxin has recently emerged as an attractive target for the development of anti-cancer chemotherapeutics. In addition, Serum ATX activity was found to be enhanced in relation to hepatic fibrosis in chronic liver disease due to hepatitis virus C infection.

References

Tania M, et al. (2010) Autotaxin: a protein with two faces. Biochem Biophys Res Commun. 401(4): 493-7.

Ikeda H, et al. (2009) Significance of serum autotaxin activity in gastrointestinal disease. Rinsho Byori. 57(5): 445-9.

Parrill AL, et al. (2008) Autotaxin inhibition: challenges and progress toward novel anti-cancer agents. Anticancer Agents Med Chem. 8(8): 917-23.

Pradere J.P, et al. (2007) Secretion and lysophospholipase D activity of autotaxin by adipocytes are controlled by N-glycosylation and signal peptidase. Biochim Biophys Acta. 1771: 93-102.

Boucher J, et al. (2005) Potential involvement of adipocyte insulin resistance in obesity-associated up-regulation of adipocyte lysophospholipase D/autotaxin expression. Diabetologia. 48: 569-77.

Catalog Number:CGA685-NM