Rhesus ALK-7 / ACVR1C Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:CGA348-NF

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1482bp
Gene Synonym
ACVR1C
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rhesus activin A receptor, type IC Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
ALK-7, also known as ALK7 and ACVR1C, belongs to the ALK family. It is a type I receptor for the TGFB family of signaling molecules. TGF-β is the prototype of a protein superfamily which, in humans, contains at least 35 members, including activins, inhibins, bone morphogenetic proteins, growth/differentiation factors, and Müllerian inhibiting substance. ALK-7 is a serine-threonine kinase that can cause the activation of one of the SMAD signal transducers, SMAD2. ALK-7 has a ligand known as Nodal. Nodal stimulates the secretion of TIMP-1 and inhibits matrix metalloproteinases MMP-2 and MMP-9 activity. The overexpression of Nodal or constitutively active ALK-7 decreases cell migration and invasion, whereas knock-down of Nodal and ALK-7 has the opposite effects.
References
  • Lin YY, et al. (2012) Functional dissection of lysine deacetylases reveals that HDAC1 and p300 regulate AMPK. Nature. 482(7384):251-5.
  • He C, et al. (2010) A large-scale candidate gene association study of age at menarche and age at natural menopause. Hum Genet. 128(5):515-27.
  • Watanabe R, et al. (2008) Insulin gene is a target in activin receptor-like kinase 7 signaling pathway in pancreatic beta-cells. Biochem Biophys Res Commun. 377(3):867-72.
  • TOP