Rat ALK-4 / ACVR1B Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Rat

NCBI Ref Seq

NM_199230.1

RefSeq ORF Size

1518bp

Gene Synonym

Skr2, Acvr1b

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat activin A receptor, type IB Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

ALK-4 (Activin Receptor-Like Kinase 4) or ACVR1B (Activin A Receptor, type 1B), belongs to the protein kinase superfamily, TKL Ser/Thr protein kinase family, and TGFB receptor subfamily. ALK-4/ACVR1B acts as a transducer of activin or activin like ligands signals. Activin binds to either ACVR2A or ACVR2B and then forms a complex with ACVR1B. The known type II activin receptors include ActRII and ActRIIB, while the main type I activin receptor in mammalian cells is ALK-4 (ActRIB). In the presence of activin, type II and type I receptors form complexes whereby the type II receptors activate ALK-4 through phosphorylation. The activated ALK-4, in turn, transduces signals downstream by phosphorylation of its effectors, such as Smads, to regulate gene expression and affect cellular phenotype. ALK-4/ACVR1B is an important regulator of vertebrate development, with roles in mesoderm induction, primitive streak formation, gastrulation, dorsoanterior patterning, and left-right axis determination.

References

Chen Y, et al. (2005) Developmental analysis of activin-like kinase receptor-4 (ALK4) expression in Xenopus laevis. 232(2): 393-8.

J. Massagu. (1998) TGF- SIGNAL TRANSDUCTION. Annual Review of Biochemistry. 67: 753-91.

Catalog Number:CGA346-NY