Rat ALK-3 / BMPR1A Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_030849.1

RefSeq ORF Size

1599bp

Gene Synonym

Bmpr1a

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat bone morphogenetic protein receptor, type IA Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Activin receptor-Like Kinase 3 (ALK-3), also known as Bone Morphogenetic Protein Receptor, type IA (BMPR1A), is a type I receptor for bone morphogenetic proteins (BMPs) which belong to the transforming growth factor beta (TGF-β) superfamily. The BMP receptors form a subfamily of transmembrane serine/threonine kinases including the type I receptors BMPR1A and BMPR1B and the type II receptor BMPR2. ALK-3/BMPR1A is expressed in the epithelium during branching morphogenesis. Deletion of BMPR1A in the epithelium with an Sftpc-cre transgene leads to dramatic defects in lung development. ALK-3 and ALK-6 share a high degree of homology, yet possess distinct signaling roles. The transforming growth factor (TGF)-beta type III receptor (TbetaRIII) enhanced both ALK-3 and ALK-6 signaling. TbetaRIII associated with ALK-3 primarily through their extracellular domains, whereas its interaction with ALK-6 required both the extracellular and cytoplasmic domains. ALK-3 plays an essential role in the formation of embryonic ventral abdominal wall, and abrogation of BMP signaling activity due to gene mutations in its signaling components could be one of the underlying causes of omphalocele at birth. The type IA BMP receptor, ALK-3 was specifically required at mid-gestation for normal development of the trabeculae, compact myocardium, interventricular septum, and endocardial cushion. Cardiac muscle lacking ALK-3 was specifically deficient in expressing TGFbeta2, an established paracrine mediator of cushion morphogenesis. Hence, ALK-3 is essential, beyond just the egg cylinder stage, for myocyte-dependent functions and signals in cardiac organogenesis.

References

Gaussin V, et al. (2002) Endocardial cushion and myocardial defects after cardiac myocyte-specific conditional deletion of the bone morphogenetic protein receptor ALK3. Proc Natl Acad Sci U S A. 99(5): 2878-83.

Eblaghie MC, et al. (2006) Evidence that autocrine signaling through Bmpr1a regulates the proliferation, survival and morphogenetic behavior of distal lung epithelial cells. Dev Biol. 291(1): 67-82.

Sun J, et al. (2007) Deficient Alk3-mediated BMP signaling causes prenatal omphalocele-like defect. Biochem Biophys Res Commun. 360(1): 238-43.

Lee NY, et al. (2009) The transforming growth factor-beta type III receptor mediates distinct subcellular trafficking and downstream signaling of activin-like kinase (ALK)3 and ALK6 receptors. Mol Biol Cell. 20(20): 4362-70.

Catalog Number:CGA345-NM