Mouse HIST3H2A Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Mouse

NCBI Ref Seq

NM_178218.3

RefSeq ORF Size

393bp

Gene Synonym

Hist3h2a

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse histone cluster 3, H2a Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Histones are a complex family of highly conserved basic proteins responsible for packaging chromosomal DNA into nucleosomes. There are subtype diversities: H1, H2A, H2B and H3 or H4. It has become more and more evident that histone modifications are key players in the regulation of chromatin states and dynamics as well as in gene expression. Therefore, histone modifications and the enzymatic machineries that set them are crucial regulators that can control cellular proliferation, differentiation, plasticity, and malignancy processes. However, extracellular histones are a double-edged sword because they also damage host tissue and may cause death. Histones bound to platelets, induced calcium influx, and recruited plasma adhesion proteins such as fibrinogen to induce platelet aggregation. Histone cluster 3, H2a also known as histone H2A (HIST3H2A) is a member of histones. Covalent modification of histones is important in regulating chromatin dynamics and transcription. One example of such modification is ubiquitination, which mainly occurs on histones H2A and H2B. E3 ubiquitin ligase complex is specific for histone H2A (HIST3H2A). Reducing the expression of Ring2 results in a dramatic decrease in the level of ubiquitinated H2A in HeLa cells. DNA damage induces monoubiquitylation of histone H2A (HIST3H2A) in the vicinity of DNA lesions.

References

Fuchs TA, et al. (2011) Histones induce rapid and profound thrombocytopenia in mice. Blood. 118(13): 3708-14.

Collart D, et al. (1993) A human histone H2B.1 variant gene, located on chromosome 1, utilizes alternative 3' end processing. J Cell Biochem. 50 (4): 374-85.

Marzluff WF, et al. (2002) The human and mouse replication-dependent histone genes. Genomics. 80 (5): 487-98.

Wang HB, et al. (2004) Role of histone H2A ubiquitination in Polycomb silencing. Nature. 431: 873-8.

Catalog Number:VGD599-NO