Mouse ASAH2 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Mouse

NCBI Ref Seq

NM_018830.1

RefSeq ORF Size

2271bp

Gene Synonym

AI585898

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse N-acylsphingosine amidohydrolase 2 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

ASAH2 (N-acylsphingosine amidohydrolase 2), also known as neutral ceramidase, is a type II integral membrane protein that can be cleaved to produce a soluble secreted protein. The enzyme is abundant in the brush border membranes of the intestine, and also expressed in several tissues such as kidney, brain and liver. The primary structure of ASAH2/neutral ceramidase is highly conserved from bacteria to humans, however, there is a clear difference in the molecular architecture. The murine ASAH2 possesses ‘amucin box’, a Ser/Thr/Pro-rich domain glycosylated with O-glycans which is necessary to retain the enzyme on the plasma membrane as a type II integral protein. The major physiological function of ASAH2/neutral ceramidase is the metabolism of dietary sphingolipids, and thus plays a role in the generation of messenger molecules such as sphingosine and sphingosine 1-phosphate.

References

Tani M, et al. (2000) Molecular cloning of the full-length cDNA encoding mouse neutral ceramidase. A novel but highly conserved gene family of neutral/alkaline ceramidases. J Biol Chem. 275(15): 11229-34.

Franzen R, et al. (2002) Nitric oxide induces neutral ceramidase degradation by the ubiquitin/proteasome complex in renal mesangial cell cultures. FEBS Lett. 532(3): 441-4.

Kono M, et al. (2006) Neutral ceramidase encoded by the Asah2 gene is essential for the intestinal degradation of sphingolipids. J Biol Chem. 281(11): 7324-31.

Catalog Number:VGA581-NO