Mouse ASAH2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:VGA581-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2271bp
Gene Synonym
AI585898
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse N-acylsphingosine amidohydrolase 2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
ASAH2 (N-acylsphingosine amidohydrolase 2), also known as neutral ceramidase, is a type II integral membrane protein that can be cleaved to produce a soluble secreted protein. The enzyme is abundant in the brush border membranes of the intestine, and also expressed in several tissues such as kidney, brain and liver. The primary structure of ASAH2/neutral ceramidase is highly conserved from bacteria to humans, however, there is a clear difference in the molecular architecture. The murine ASAH2 possesses ‘amucin box’, a Ser/Thr/Pro-rich domain glycosylated with O-glycans which is necessary to retain the enzyme on the plasma membrane as a type II integral protein. The major physiological function of ASAH2/neutral ceramidase is the metabolism of dietary sphingolipids, and thus plays a role in the generation of messenger molecules such as sphingosine and sphingosine 1-phosphate.
References
  • Tani M, et al. (2000) Molecular cloning of the full-length cDNA encoding mouse neutral ceramidase. A novel but highly conserved gene family of neutral/alkaline ceramidases. J Biol Chem. 275(15): 11229-34.
  • Franzen R, et al. (2002) Nitric oxide induces neutral ceramidase degradation by the ubiquitin/proteasome complex in renal mesangial cell cultures. FEBS Lett. 532(3): 441-4.
  • Kono M, et al. (2006) Neutral ceramidase encoded by the Asah2 gene is essential for the intestinal degradation of sphingolipids. J Biol Chem. 281(11): 7324-31.
  • TOP