Mouse SIRPB1A Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:TGH062-CY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1176bp
Gene Synonym
Sirpb, Sirpb1, SIRP-beta, 9930027N05Rik, Sirpb1a
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse signal-regulatory protein beta 1A Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
SIRPB1A (Signal-regulatory protein beta 1A), also known as SIRP beta 1, belongs to signal-regulatory-protein (SIRP) family, and immunoglobulin superfamily. Signal-regulatory proteins (SIRPs) are cell-surface glycoproteins expressed on myeloid and neural cells that have been shown to recruit SH2 domain-containing protein phosphatase 1 (SHP-1) and SHP-2 and to regulate receptor tyrosine kinase-coupled signaling. SIRP are classified as SIRP alpha molecules, containing a 110- to 113-amino acid long, or SIRP beta molecules, with a 5-amino acid long intracytoplasmic domain. SIRP beta 1 is a new DAP12-associated receptor involved in the activation of myeloid cells, which contains a short cytoplasmic domain that lacks sequence motifs capable of recruiting SHP-1 and SHP-2. SIRP beta 1. SIRP beta 1 acts as an activating isoform of SIRP alpha molecules, confirming the co-existence of inhibitory ITIM-bearing molecules, recruiting SHP-1 and SHP-2 protein tyrosine phosphatases, and activating counterparts, whose engagement couples to protein tyrosine kinases via ITAM-bearing molecules.
References
  • Gaikwad S, et al. (2009) Signal regulatory protein-beta1: a microglial modulator of phagocytosis in Alzheimer's disease. Am J Pathol. 175(6): 2528-39.
  • Dietrich J, et al. (2000) Cutting edge: signal-regulatory protein beta 1 is a DAP12-associated activating receptor expressed in myeloid cells. J Immunol. 164(1): 9-12.
  • Tomasello E, et al. (2000) Association of signal-regulatory proteins beta with KARAP/DAP-12. Eur J Immunol. 30(8): 2147-56.
  • TOP