Mouse SLITRK1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_199065.2

RefSeq ORF Size

2091bp

Gene Synonym

3200001I04Rik, Slitrk1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse SLIT and NTRK-like family, member 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

SLITRK1 (Slit and Trk-like family member 1) is a integral membrane protein belonging to the SLITRK family consists of at least 6 members (SLITRK1-6). They are named and characterized by the presence of two leucine-rich repeats (LRRs) in the extracellular domain similar to those found in a secreted axonal growth-controlling protein, Slit, as well as a C-terminal domain with homology to Trk neurotrophin tyrosine kinase receptors. Expression of SLITRKs are highly restricted to neural tissues, and are identified as the neuronal components modulating the neurite outgrowth. More specifically, SLITRK1 expression is found in the mature neurons of the cerebrum, thalamus and hippocampus, and induces unipolar neurites in cultured neuronal cells. Human SLITRK1 is a 696 amino acid precursor protein, and one truncating frameshift mutation (448 aa) has been linked to Tourette's syndrome, a genetically influenced developmental neuropsychiatric disorder characterized by chronic vocal and motor tics. In addition, all SLITRK genes are differentially expressed in brain tumors, such as astrocytoma, oligodendroglioma, glioblastoma, and are suggested to be useful molecular indicators of brain tumor properties.

References

1. Aruga, J. and Mikoshiba, K. 2003, Mol. Cell. Neurosci. 24: 117-129.

2. Aruga, J. et al., 2003, Gene. 315: 87-94.

3. Abelson, J.F. et al., 2005, Science. 310: 317-320.

4. Grados, M.A. and Walkup. J.T. 2006, Trends. Genet. 22: 291-293.

Catalog Number:RGH200-NY