Mouse SLITRK1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_199065.2

RefSeq ORF Size

2091bp

Gene Synonym

3200001I04Rik, Slitrk1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse SLIT and NTRK-like family, member 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

SLITRK1 (Slit and Trk-like family member 1) is a integral membrane protein belonging to the SLITRK family consists of at least 6 members (SLITRK1-6). They are named and characterized by the presence of two leucine-rich repeats (LRRs) in the extracellular domain similar to those found in a secreted axonal growth-controlling protein, Slit, as well as a C-terminal domain with homology to Trk neurotrophin tyrosine kinase receptors. Expression of SLITRKs are highly restricted to neural tissues, and are identified as the neuronal components modulating the neurite outgrowth. More specifically, SLITRK1 expression is found in the mature neurons of the cerebrum, thalamus and hippocampus, and induces unipolar neurites in cultured neuronal cells. Human SLITRK1 is a 696 amino acid precursor protein, and one truncating frameshift mutation (448 aa) has been linked to Tourette's syndrome, a genetically influenced developmental neuropsychiatric disorder characterized by chronic vocal and motor tics. In addition, all SLITRK genes are differentially expressed in brain tumors, such as astrocytoma, oligodendroglioma, glioblastoma, and are suggested to be useful molecular indicators of brain tumor properties.

References

1. Aruga, J. and Mikoshiba, K. 2003, Mol. Cell. Neurosci. 24: 117-129.

2. Aruga, J. et al., 2003, Gene. 315: 87-94.

3. Abelson, J.F. et al., 2005, Science. 310: 317-320.

4. Grados, M.A. and Walkup. J.T. 2006, Trends. Genet. 22: 291-293.

Catalog Number:RGH200-CF