Mouse ATG8/GABARAPL1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_020590.4

RefSeq ORF Size

354bp

Gene Synonym

GECI; Apg8l; Atg8l; AI196471; MNCb-0091; 3110025G09Rik; 9130422N19Rik

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse gamma-aminobutyric acid (GABA) A receptor-associated protein-like 1 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

ATG8, also known as GABARAPL1, is a ubiquitin-like protein which has a crystal structure. ATG8 consists of a 5-stranded β-sheet, which is enclosed by two α-helices at one side and one α-helix at the other side and exhibits a conserved GABARAP domain. It functions in the formation of autophagosomal membranes. The transient conjugation of ATG8 to the autophagosomal membrane through a ubiquitin-like conjugation system is essential for autophagy in eukaryotes. Autophagy is induced upon nutrient depletion or rapamycin treatment and leads to the response of more than 30 autophagy-related (ATG) genes known so far, including ATG8.

References

Ohsumi Y, et al. (2004) The crystal structure of microtubule-associated protein light chain 3, a mammalian homologue of Saccharomyces cerevisiae Atg8. Genes Cells. 9(7):611-8.

Geng J, et al. (2008) The Atg8 and Atg12 ubiquitin-like conjugation systems in macroautophagy. 'Protein modifications: beyond the usual suspects' review series. EMBO Rep. 9(9):859-644.

Suzuki NN, et al. (2005) The crystal structure of plant ATG12 and its biological implication in autophagy. Autophagy. 1(2):119-126.

Catalog Number:HGA634-NY