Mouse ATF2 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGA623-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1464bp
Gene Synonym
mXBP, Atf-2, Creb2, CRE-BP, D18875, MGC105211, MGC105222, D130078H02Rik, Tg(Gzma-Klra1)7Wum, Atf2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse activating transcription factor 2, isfrom 1 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Activating transcription factor 2, also known as ATF2, is a member of the leucine zipper family of DNA-binding proteins that binds to the cAMP response element. Its activity is enhanced after phosphorylation by stress-activated protein kinases such as c-Jun N-terminal kinase and p38. ATF2 has been found to be a target of the JNK signal transduction pathway and mediate adenovirus E1A-inducible transcriptional activation. ATF2 is also been reported playing roles in TGF-β signaling pathway. It has been shown that the transcription factor ATF2 is bound by a hetero-oligomer of Smad3 and Smad4 upon TGF-β stimulation. Studies indicate that ATF-2 plays a central role in TGF-β signaling by acting as a common nuclear target of both Smad and TAK1 pathways. 
References
  • Livingstone C, et al. (1995) ATF-2 contains a phosphorylation-dependent transcriptional activation domain. EMBO J. 14 (8): 1785-97.
  • Gupta S, et al. (1995) Transcription factor ATF2 regulation by the JNK signal transduction pathway. Science . 267 (5196): 389-93.
  • Sano YJ, et al. (1999) ATF-2 Is a Common Nuclear Target of Smad and TAK1 Pathways in Transforming Growth Factor-_ Signaling. The Journal of Biological Chemistry. 274: 8949-57.
  • TOP