Rat APEX1/APE1/Ref-1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Rat

NCBI Ref Seq

NM_024148.1

RefSeq ORF Size

954bp

Gene Synonym

APE, Apex, REF-1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat APEX nuclease (multifunctional DNA repair enzyme) 1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

The enzyme is known to be a redox factor (Ref-1) stimulating DNA binding activity of AP-1 binding proteins such as Fos and Jun as well as a multifunctional DNA repair enzyme having 5' AP endonuclease, DNA 3' repair diesterase, 3'-5' exonuclease and DNA 3'-phosphatase activities.Although Apex mRNA was expressed ubiquitously, the levels varied significantly, suggesting organ- or tissue-specific expression of the Apex gene. The highest level was observed in the testis, relatively high levels in the thymus, spleen, kidney and brain, and the lowest level in the liver in rats. However, the present results suggested that APEX/Ref-1 gene product can interact with AP-1 binding proteins in brain, especially in the hippocampal formation, to regulate some brain functions by redox-activation.

References

Ono Y, et al. (1995) Developmental expression of APEX nuclease, a multifunctional DNA repair enzyme, in mouse brains. Brain Res Dev Brain Res.86 (1-2): 1-6.

Tan Y, et al. (1996) cDNA cloning of rat major AP endonuclease (APEX nuclease) and analyses of its mRNA expression in rat tissues. Acta Med Okayama. 50 (1): 53-60.

Yao M, et al. (1999) Genomic structure of the rat major AP endonuclease gene (Apex) with an adjacent putative O-sialoglycoprotease gene (Prsmg1/Gcpl1) and a processed Apex pseudogene (Apexp1). Acta Med Okayama. 53 (6): 245-52.

Catalog Number:FGA464-CO