Canine ACVR2A Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Canine

NCBI Ref Seq

XM_852167.3

RefSeq ORF Size

1218bp

Gene Synonym

ACVR2A

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Canine activin A receptor, type IIA Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

ACVR2A and ACVR2B are two activin type II receptors. ACVR2A has been shown to interact with INHBA, SYNJ2BP and ACVR1B. The bovine ACVR2A gene encodes a protein of 513 amino acids which is highly homologous (approximately 98% identity) to the rat, mouse, and human ACVR2A proteins. Inactivation of ACVR2A is a common event in prostate cancer cells suggesting it may play an important role in the development of prostate cancer. The ACVR2A gene is a putative tumor suppressor gene that is frequently mutated in microsatellite-unstable colon cancers (MSI-H colon cancers). Frameshift mutation of ACVR2A may contribute to MSI-H colon tumorigenesis via disruption of alternate TGF-beta effector pathways.

References

Albertson RC, et al. (2005) Zebrafish acvr2a and acvr2b exhibit distinct roles in craniofacial development. Developmental dynamics 233(4): 1405-18.

Chung H, et al. (2008) Mutation rates of TGFBR2 and ACVR2 coding microsatellites in human cells with defective DNA mismatch repair. PloS one 3(10): e3463.

Fitzpatrick E, et al. (2009) Genetic association of the activin A receptor gene (ACVR2A) and pre-eclampsia. Molecular human reproduction 15(3):195-204.

Roten LT, et al. (2009) Association between the candidate susceptibility gene ACVR2A on chromosome 2q22 and pre-eclampsia in a large Norwegian population-based study (the HUNT study). EJHG. 17(2): 250-7.

Catalog Number:CGA178-CY